Comment les cellules lisent-elles les gènes ?

La séquence d’ADN d’un gène détermine la séquence d’acides aminés de la protéine qu’il code. Dans la région codant pour les protéines d’un gène, la séquence d’ADN est interprétée en groupes de trois bases nucléotidiques, appelés codons. Chaque codon spécifie un seul acide aminé dans une protéine.

L’ADN en tant que phrase

On peut considérer la séquence de codage des protéines d’un gène comme une phrase composée entièrement de mots de 3 lettres. Dans la séquence, chaque mot de 3 lettres est un codon, spécifiant un seul acide aminé dans une protéine. Jetez un coup d’œil à cette phrase :

Lesdésontétémissuruneclé

Si vous deviez diviser cette phrase en mots de 3 lettres, vous la liriez probablement comme ceci :

Les dés ont été mis sur une clé

Cette phrase représente un gène. Chaque lettre correspond à une base nucléotidique, et chaque mot représente un codon. Et si vous changiez la manière de lire en faisant d’autre découpages ? Vous vous retrouveriez avec :

Le sdé son tété mis suru neclé ou encore L esd és ont étém issu run eclé

Comme vous pouvez le constater, une seule manière de découper ces mots permet de faire phrase compréhensible. De la même manière, il n’y a qu’un seule façon de lire un gène pour qu’il code la bonne protéine.

La mutation d’une phrase d’ADN

Prenez cette séquence ADN :

GCATGCTCTGCTGCGAAACTTTTTGGCTGA

Vous pouvez séparer la séquence en codons de 3 lettres, de 3 façons différentes :

GCA TGC TGC TGC GAA ACT TTG TTG GCT GA
G CAT GCT GCT GCG AAA CTT TGG TGG CTG A
GC ATG CTG CTG CGA AAC TTT GGC TTT GGC TGA

Comment savoir de quelle manière les lire et comment trouver la bonne manière de les lire ?

Toutes les régions codant pour les protéines commencent par la séquence “ATG”, qui code pour la méthionine (Met), un acide aminé. Par conséquent, le cadre de lecture correct contiendra le codon “ATG.”

Génome humain code génétique de l'ADN et ARN
Présentation du code génétique et de ses codons de départ (start) et d’arrêt (stop) sous une forme schématisée et originale.

Vous pouvez prédire la séquence d’acides aminés de la protéine en utilisant le code génétique.

Le code génétique

Codons stop ou codons d'arrêt
Les 3 codons-stop qui terminent la traduction d’une séquence d’ARNm en protéine.

Le code génétique est le manuel d’instructions que toutes les cellules utilisent pour lire la séquence d’ADN d’un gène et construire une protéine correspondante. Les protéines sont composées d’acides aminés qui s’enchaînent en une chaîne. Chaque séquence d’ADN de 3 lettres, ou codon, code un acide aminé spécifique.

Le code a plusieurs caractéristiques clés :

Toutes les régions de codage des protéines commencent par le codon de départ, ATG.
Il y a trois codons “stop” qui marquent la fin de la région de codage des protéines: UAA (ocre), UAG (ambre) et UGA (opale).
Plusieurs codons peuvent coder pour le même acide aminé.

 

La mutation

La mutation est un processus qui modifie de façon permanente une séquence d’ADN. Changer la séquence d’ADN d’un gène peut changer la séquence d’acides aminés de la protéine qu’il code.

Mutations ponctuelles

Les mutations ponctuelles sont des changements de base uniques dans la séquence d’ADN d’un gène. Elles peuvent être catégorisés plus en détail :

Les mutations malencontreuses provoquent un seul changement d’acide aminé dans la protéine.
Des mutations absurdes créent un codon “stop” prématuré qui raccourcit la protéine.
Les mutations silencieuses ne causent pas de changements d’acides aminés.

Mutations d’insertion et de suppression

Les mutations d’insertion et de suppression ajoutent ou suppriment une ou plusieurs bases d’ADN. Les insertions et les délétions (à moins qu’elles ne se produisent par multiples de 3) peuvent déplacer le cadre de lecture d’un gène, modifiant le groupement des bases en codons. Aussi appelées mutations de décalage de trames, ces changements peuvent grandement affecter la séquence d’acides aminés d’une protéine.

 

Laisser un commentaire

Votre adresse email ne sera pas publiée.